ID: 1181550933_1181550941

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1181550933 1181550941
Species Human (GRCh38) Human (GRCh38)
Location 22:23638827-23638849 22:23638867-23638889
Sequence CCATCAAGATTCCCGGATAAAGT AGTGTGGCCTTGTTGGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 64} {0: 1, 1: 0, 2: 1, 3: 10, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!