ID: 1181554690_1181554699

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1181554690 1181554699
Species Human (GRCh38) Human (GRCh38)
Location 22:23662021-23662043 22:23662067-23662089
Sequence CCAGCCTGACTAACATGGTGAAA AGTTATCTGGGCATGATGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 39, 2: 1132, 3: 12400, 4: 37919}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!