ID: 1181558260_1181558270

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1181558260 1181558270
Species Human (GRCh38) Human (GRCh38)
Location 22:23684566-23684588 22:23684596-23684618
Sequence CCCAACCGCCTTGCTCCCCACAT TGCTTGCAGGAAGCCAAAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!