ID: 1181563098_1181563110

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1181563098 1181563110
Species Human (GRCh38) Human (GRCh38)
Location 22:23717037-23717059 22:23717075-23717097
Sequence CCCACCGCCGGGCTTCCGGGCGA CGAGTCCGCGCCTCCGACAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 44} {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!