ID: 1181571052_1181571057

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1181571052 1181571057
Species Human (GRCh38) Human (GRCh38)
Location 22:23767979-23768001 22:23767992-23768014
Sequence CCCCGGGCGGGGCCTCAGGAACA CTCAGGAACACGCCCCCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128} {0: 1, 1: 0, 2: 0, 3: 14, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!