ID: 1181582639_1181582644

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1181582639 1181582644
Species Human (GRCh38) Human (GRCh38)
Location 22:23836712-23836734 22:23836750-23836772
Sequence CCAGTGCTGTGGGCCAAGAGACT TATTCAGGTGGGCCCTTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 155} {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!