ID: 1181582640_1181582644

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1181582640 1181582644
Species Human (GRCh38) Human (GRCh38)
Location 22:23836725-23836747 22:23836750-23836772
Sequence CCAAGAGACTGCAGCTCATTCTG TATTCAGGTGGGCCCTTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 217} {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!