ID: 1181597800_1181597804

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1181597800 1181597804
Species Human (GRCh38) Human (GRCh38)
Location 22:23928446-23928468 22:23928482-23928504
Sequence CCTCAGGCTCGCCAGTGGAATTT TCTACTCCTAGGAGCACAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 8, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!