ID: 1181598042_1181598045

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1181598042 1181598045
Species Human (GRCh38) Human (GRCh38)
Location 22:23930382-23930404 22:23930408-23930430
Sequence CCTCTTGTGGAGGGCCTGACATC CAGGCCCGCCTGCAGTTATCCGG
Strand - +
Off-target summary No data {0: 4, 1: 36, 2: 89, 3: 131, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!