ID: 1181606316_1181606324

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1181606316 1181606324
Species Human (GRCh38) Human (GRCh38)
Location 22:23982055-23982077 22:23982092-23982114
Sequence CCAAGGGCACAGCTCATGGTGAG CAGGAAAAGGACAAGAGGTCAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 3, 3: 35, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!