ID: 1181631895_1181631902

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1181631895 1181631902
Species Human (GRCh38) Human (GRCh38)
Location 22:24155978-24156000 22:24156003-24156025
Sequence CCCCGGCCCGCCGCGAGCGAGAG CGAACGAGCCTCCGCGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 71} {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!