ID: 1181632218_1181632236

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1181632218 1181632236
Species Human (GRCh38) Human (GRCh38)
Location 22:24157201-24157223 22:24157242-24157264
Sequence CCTGGCCTGCTTCTGGGGCCCCT GAGGAACAGGACTGCGGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 12, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!