ID: 1181634509_1181634514

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1181634509 1181634514
Species Human (GRCh38) Human (GRCh38)
Location 22:24168350-24168372 22:24168370-24168392
Sequence CCTACCTAGGCTGGTCTGTGCTA CTACATACACAGACAGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103} {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!