ID: 1181639007_1181639027

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1181639007 1181639027
Species Human (GRCh38) Human (GRCh38)
Location 22:24187187-24187209 22:24187240-24187262
Sequence CCCCCTTGAGCCCAGGAATGTTC ATCATGCTGGCATCAGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172} {0: 1, 1: 0, 2: 1, 3: 29, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!