ID: 1181639497_1181639508

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1181639497 1181639508
Species Human (GRCh38) Human (GRCh38)
Location 22:24189244-24189266 22:24189282-24189304
Sequence CCCTCCCCAGGCTCTCTCTCCAT GAGAACTGTGGCCGCCTCGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 84, 4: 891} {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!