ID: 1181643891_1181643899

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1181643891 1181643899
Species Human (GRCh38) Human (GRCh38)
Location 22:24219984-24220006 22:24220014-24220036
Sequence CCTCCCCACTCTTCCTCAGGTCC CGTACACACAGGCCCCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 481} {0: 1, 1: 1, 2: 0, 3: 6, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!