ID: 1181647663_1181647667

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1181647663 1181647667
Species Human (GRCh38) Human (GRCh38)
Location 22:24242555-24242577 22:24242606-24242628
Sequence CCACTGCACTCCAGCCTGGTGAC CAGAAAAAAGAGCAGGAGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 73, 4: 785}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!