ID: 1181647665_1181647667

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1181647665 1181647667
Species Human (GRCh38) Human (GRCh38)
Location 22:24242569-24242591 22:24242606-24242628
Sequence CCTGGTGACAGAGCGAAACAGCA CAGAAAAAAGAGCAGGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 56, 3: 1223, 4: 5287} {0: 1, 1: 0, 2: 4, 3: 73, 4: 785}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!