ID: 1181648713_1181648717

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1181648713 1181648717
Species Human (GRCh38) Human (GRCh38)
Location 22:24247346-24247368 22:24247391-24247413
Sequence CCTGGAGGGGCTGCTGATGGTGA CCTTCCAAACCCACTCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 9, 3: 37, 4: 292} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!