ID: 1181651524_1181651532

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1181651524 1181651532
Species Human (GRCh38) Human (GRCh38)
Location 22:24261685-24261707 22:24261729-24261751
Sequence CCTCGCAGGGCTCAGCAGCACCC CCGCTAGAGCAGCTGCTCATGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 4, 3: 38, 4: 339} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!