ID: 1181654647_1181654653

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1181654647 1181654653
Species Human (GRCh38) Human (GRCh38)
Location 22:24286982-24287004 22:24287021-24287043
Sequence CCCTAAATGTTGTCTGGATAAAA CTGTGGCCAGAAAGGTAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 39, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!