ID: 1181675040_1181675047

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1181675040 1181675047
Species Human (GRCh38) Human (GRCh38)
Location 22:24445834-24445856 22:24445866-24445888
Sequence CCAGGCCAGGAAGTCAGCATGAG GTGACAGGTGTAGCCAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 25, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!