ID: 1181683812_1181683816

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1181683812 1181683816
Species Human (GRCh38) Human (GRCh38)
Location 22:24514805-24514827 22:24514825-24514847
Sequence CCGGGCTCCACCGTTCTATATAA TAATGACATGTGATTGCTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!