ID: 1181690612_1181690625

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1181690612 1181690625
Species Human (GRCh38) Human (GRCh38)
Location 22:24557308-24557330 22:24557354-24557376
Sequence CCAGTCCCCCTCCCCTGACACAC AGCTGAAGATTAAGGGACATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 87, 4: 830} {0: 1, 1: 0, 2: 0, 3: 21, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!