ID: 1181694976_1181694991

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1181694976 1181694991
Species Human (GRCh38) Human (GRCh38)
Location 22:24588484-24588506 22:24588525-24588547
Sequence CCAACCCGGCTGTGGCCTGGCAC CCTCTGGGAGCTGGACAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173} {0: 1, 1: 0, 2: 4, 3: 67, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!