ID: 1181709611_1181709617

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1181709611 1181709617
Species Human (GRCh38) Human (GRCh38)
Location 22:24674219-24674241 22:24674270-24674292
Sequence CCCTTCTCCAAGACACTGGAAGT GCTCTGTAATCTCTACCTGGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 18, 4: 223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!