ID: 1181737334_1181737347

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1181737334 1181737347
Species Human (GRCh38) Human (GRCh38)
Location 22:24892231-24892253 22:24892272-24892294
Sequence CCTTGGGCAGGATGGACCCTCAG GAGTAGCCATAGGAGAGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!