ID: 1181737340_1181737347

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1181737340 1181737347
Species Human (GRCh38) Human (GRCh38)
Location 22:24892258-24892280 22:24892272-24892294
Sequence CCTCCCGAAGTCCTGAGTAGCCA GAGTAGCCATAGGAGAGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!