ID: 1181737496_1181737503

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1181737496 1181737503
Species Human (GRCh38) Human (GRCh38)
Location 22:24893241-24893263 22:24893294-24893316
Sequence CCTTGCTCCCTTTGTGTCTTCAG GGTGCTCAGTTAATATCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 390} {0: 1, 1: 0, 2: 13, 3: 81, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!