ID: 1181741334_1181741338

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1181741334 1181741338
Species Human (GRCh38) Human (GRCh38)
Location 22:24924101-24924123 22:24924120-24924142
Sequence CCAGAGAAGCCTCCAGGGGCTGG CTGGAATTGTACCCTAAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 358} {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!