ID: 1181744381_1181744389

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1181744381 1181744389
Species Human (GRCh38) Human (GRCh38)
Location 22:24945689-24945711 22:24945717-24945739
Sequence CCACACCATGAAAAAGCCTGGGG CTGGGGACAAGCACAGAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!