ID: 1181757397_1181757401

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1181757397 1181757401
Species Human (GRCh38) Human (GRCh38)
Location 22:25033976-25033998 22:25034009-25034031
Sequence CCTGTGAAACCACCATCACAGTC ACATCTCCATCCCAGGCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 23, 3: 143, 4: 569} {0: 1, 1: 0, 2: 2, 3: 26, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!