ID: 1181786587_1181786599

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1181786587 1181786599
Species Human (GRCh38) Human (GRCh38)
Location 22:25231596-25231618 22:25231638-25231660
Sequence CCCTGCAGGTGGGTTGGCTACCA CTGCAGTACCTGCTGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 80} {0: 2, 1: 0, 2: 3, 3: 35, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!