ID: 1181826381_1181826386

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1181826381 1181826386
Species Human (GRCh38) Human (GRCh38)
Location 22:25519651-25519673 22:25519680-25519702
Sequence CCTGGAAGGTACTAGACACCCTG CCTTGCTAGCGTACTCCTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!