ID: 1181826434_1181826443

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1181826434 1181826443
Species Human (GRCh38) Human (GRCh38)
Location 22:25519993-25520015 22:25520042-25520064
Sequence CCACGCAGACCTCTGCAACACAC CCCATCAACTACAAGAAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 11, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!