ID: 1181831749_1181831756

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1181831749 1181831756
Species Human (GRCh38) Human (GRCh38)
Location 22:25565244-25565266 22:25565259-25565281
Sequence CCTCCGCTGCCCCGGGGCGGGTG GGCGGGTGACACAGCGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 240} {0: 1, 1: 1, 2: 0, 3: 11, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!