ID: 1181831762_1181831771

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1181831762 1181831771
Species Human (GRCh38) Human (GRCh38)
Location 22:25565296-25565318 22:25565318-25565340
Sequence CCTCGTCGTTCCAGTCTCTGAAA ATGGGGCATCGGAGGGCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102} {0: 1, 1: 2, 2: 1, 3: 13, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!