ID: 1181872420_1181872426

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1181872420 1181872426
Species Human (GRCh38) Human (GRCh38)
Location 22:25910652-25910674 22:25910674-25910696
Sequence CCATGGCTGCAGGAGAGAGGCAT TCTCTTCTACTGGGGACCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 691} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!