ID: 1181887186_1181887193

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1181887186 1181887193
Species Human (GRCh38) Human (GRCh38)
Location 22:26030637-26030659 22:26030672-26030694
Sequence CCTGGGCATCTGTGCCTTCTCTA CTGGGATTCCAGAGAGTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 275} {0: 1, 1: 0, 2: 0, 3: 32, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!