ID: 1181891084_1181891087

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1181891084 1181891087
Species Human (GRCh38) Human (GRCh38)
Location 22:26064120-26064142 22:26064156-26064178
Sequence CCTGTCTTGTTCATTATTCTATA CAGAGCACGGAGCATGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 377} {0: 1, 1: 0, 2: 0, 3: 16, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!