ID: 1181893070_1181893074

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1181893070 1181893074
Species Human (GRCh38) Human (GRCh38)
Location 22:26081797-26081819 22:26081816-26081838
Sequence CCCTCTTTAAGATTGCTAGCAGG CAGGATAAGCGTGAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91} {0: 1, 1: 0, 2: 0, 3: 17, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!