ID: 1181898320_1181898326

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1181898320 1181898326
Species Human (GRCh38) Human (GRCh38)
Location 22:26130722-26130744 22:26130742-26130764
Sequence CCCTCCACATCCTCGCCAACACT ACTTGTTATTTTTTGTGGTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 88, 4: 733}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!