ID: 1181930596_1181930601

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1181930596 1181930601
Species Human (GRCh38) Human (GRCh38)
Location 22:26397938-26397960 22:26397960-26397982
Sequence CCTTGCTCTTAATTAGGCTTTGG GCTTAAGGAGATGTGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 35, 2: 368, 3: 655, 4: 678} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!