ID: 1181934560_1181934570

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1181934560 1181934570
Species Human (GRCh38) Human (GRCh38)
Location 22:26429426-26429448 22:26429459-26429481
Sequence CCGCGCCCTCGGGCGGCGGCGTC CGGCAGCCGTCCGCGCGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 194} {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!