ID: 1181974850_1181974852

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1181974850 1181974852
Species Human (GRCh38) Human (GRCh38)
Location 22:26721662-26721684 22:26721679-26721701
Sequence CCATGTCTTGAGATGTTTTTGGT TTTGGTTGCCGTGATTGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 56, 4: 377} {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!