ID: 1181992560_1181992567

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1181992560 1181992567
Species Human (GRCh38) Human (GRCh38)
Location 22:26848474-26848496 22:26848510-26848532
Sequence CCAGTAGCCTGATGAAATGAATA ACAGGTGAGCAGAGGGCTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 9, 3: 64, 4: 740}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!