ID: 1182024444_1182024450

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1182024444 1182024450
Species Human (GRCh38) Human (GRCh38)
Location 22:27107000-27107022 22:27107043-27107065
Sequence CCATGCTTCTTCTGGGCGCAGAG TTCCCAAGGCTTCCCTTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 184} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!