ID: 1182034123_1182034131

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1182034123 1182034131
Species Human (GRCh38) Human (GRCh38)
Location 22:27184110-27184132 22:27184158-27184180
Sequence CCACCATCAAGGTGGAATCTGTC CTGGCCAATGAACATGGTAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!