ID: 1182103855_1182103860

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1182103855 1182103860
Species Human (GRCh38) Human (GRCh38)
Location 22:27675146-27675168 22:27675177-27675199
Sequence CCAGCATTCTGAGGCCAGGACTG TACATTTCAGAAAGGCATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 250} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!