ID: 1182211925_1182211931

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1182211925 1182211931
Species Human (GRCh38) Human (GRCh38)
Location 22:28684051-28684073 22:28684080-28684102
Sequence CCCAGCTCCATTTGTTCATGTTT CCTACACCCACCTCTAGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 6, 3: 12, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!